Πανελλήνιες 2019: Απαντήσεις, Λύσεις θεμάτων Βιολογία Θετικών Σπουδών (ΓΕΛ)

Τα «Φοιτητικά Νέα» το μέσο ενημέρωσης που θα χρειάζεσαι «ως φοιτητής» σε καθημερινή βάση μετά την ανακοίνωση των αποτελεσμάτων των Πανελληνίων 2019 για την εισαγωγή σου στην Τριτοβάθμια Εκπαίδευση σου παρουσιάζουν τις λύσεις-απαντήσεις των θεμάτων του μαθήματος Βιολογία Θετικών Σπουδών ΓΕΛ από τον ΟΕΦΕ.

Τα θέματα μπορείτε να τα δείτε εδώ και τον σχολιασμό των θεμάτων εδώ.

Αν θέλεις να ενημερωθείς πρώτος για τα αποτελέσματα των Πανελλαδικών 2019 ΠΑΤΗΣΕ ΕΔΩ.

Οι λύσεις των θεμάτων του μαθήματος Βιολογία Θετικών Σπουδών ΓΕΛ από τον ΟΕΦΕ έχει ως εξής:

Βιολογία Θετικών Σπουδών 

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ

Γ΄ ΤΑΞΗ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ

Τρίτη 18 Ιουνίου 2019

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ:

ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ

(Ενδεικτικές Απαντήσεις)

ΘΕΜΑ Α

Α1. α

Α2. β

Α3. γ

Α4. γ

Α5. β

ΘΕΜΑ Β

Β1.

1-ζ

2-στ

3-α

4-ε

5-β

6-δ

Β2. Σύνθεση DNA θα γίνει στο μόριο Α, ενώ σύνθεση DNA δεν θα γίνει στα μόρια Β και Γ.

Τα κύρια ένζυμα που συμμετέχουν στην αντιγραφή του DNA ονομάζονται DNA πολυμεράσες. Επειδή τα ένζυμα αυτά δεν έχουν την ικανότητα να αρχίσουν την αντιγραφή, το κύτταρο έχει ένα ειδικό σύμπλοκο που  αποτελείται από πολλά ένζυμα, το πριμόσωμα, το οποίο συνθέτει στις θέσεις έναρξης της αντιγραφής μικρά τμήματα RNA, συμπληρωματικά προς τις μητρικές αλυσίδες, τα οποία ονομάζονται πρωταρχικά τμήματα.

Οι DNA πολυμεράσες λειτουργούν μόνο προς καθορισμένη κατεύθυνση και τοποθετούν τα νουκλεοτίδια στο ελεύθερο 3΄ άκρο της δεοξυριβόζης του τελευταίου νουκλεοτιδίου κάθε αναπτυσσόμενης αλυσίδας. Έτσι, λέμε ότι αντιγραφή γίνεται με προσανατολισμό 5΄ προς 3΄. Κάθε νεοσυντιθέμενη αλυσίδα θα έχει προσανατολισμό 5΄→3΄.

Επομένως, μόνο στο μόριο Α υπάρχει ένα ελεύθερο 3΄ άκρο στο οποίο μπορεί να συνδεθεί η DNA πολυμεράση ώστε να το επιμηκύνει με καλούπι την άλλη αλυσίδα του μορίου. Για το λόγο αυτό σύνθεση DNA μπορεί να γίνει μόνο στο μόριο Α.

Β3. α. Το άτομο είναι θηλυκό

β. Η χρωμοσωμική ανωμαλία που φέρει το άτομο ειναι το συνδρομο Turner.

γ. Τα άτομα με σύνδρομο Turner έχουν φυσιολογικό αριθμό αυτοσωμικών χρωμοσωμάτων (44) αλλά μόνο ένα χρωμόσωμα Χ από το ζεύγος των

φυλετικών χρωμοσωμάτων (ΧO). Αυτή είναι η μοναδική μονοσωμία που έχει βρεθεί στον άνθρωπο. Τα άτομα δεν εμφανίζουν δευτερογενή χαρακτηριστικά του φύλου, παρ’ όλο που έχουν φαινότυπο θηλυκού ατόμου και είναι στείρα

δ. Το άτομο με σύνδρομο Turner έχει στον καρυότυπό του 45 χρωμοσώματα. Κάθε φυσιολογικό μεταφασικό χρωμόσωμα αποτελείται από δύο αδελφές χρωματίδες, οι οποίες συγκρατούνται στο κεντρομερίδιο. Επειδή κάθε αδελφή χρωματίδα είναι ένα μόριο DNA, στην εικόνα 2 απεικονίζονται 45 x 2 = 90 μόρια DNA.

Β4. Αυτή έχει ως στόχο να «διορθώσει» τη γενετική βλάβη εισάγοντας στους ασθενείς φυσιολογικά αλληλόμορφα του μεταλλαγμένου γονιδίου. Απαραίτητη προϋπόθεση για την εφαρμογή της γονιδιακής θεραπείας είναι, εκτός από την κλωνοποίηση του υπεύθυνου γονιδίου, και ο προσδιορισμός των κυττάρων που εμφανίζουν τη βλάβη από την ασθένεια. Με τις μεθόδους της γονιδιακής θεραπείας δε γίνεται αντικατάσταση του μεταλλαγμένου γονιδίου στα κύτταρα του οργανισμού αλλά ενσωμάτωση του φυσιολογικού αντιγράφου του στο γονιδίωμα συγκεκριμένων σωματικών κυττάρων. Συνεπώς δε μεταβιβάζεται στους απογόνους. 

ΘΕΜΑ Γ

Γ1. Για το χρώμα του σώματος υπάρχουν 3 αυτοσωμικά πολλαπλά αλληλόμορφα. Έστω: Κ1: το αλληλόμορφο για το κίτρινο χρώμα,

Κ2: το αλληλόμορφο για το μαύρο χρώμα και

Κ3: το αλληλόμορφο για το άσπρο χρώμα.

Η φαινοτυπική αναλογία των απογόνων είναι:  

1 με μαύρο χρώμα σώματος :2 με κίτρινα χρώμα σώματος: 1 με άσπρο χρώμα σώματος

Άρα το αλληλόμορφο Κ1 είναι επικρατές των Κ2 και Κ3 και το Κ2 επικρατές του Κ3 και οι γονότυποι των γονέων για τον συγκεκριμένο χαρακτήρα θα είναι:

Ρ γενιά: Κ1Κ3 x K2K3

Παρατηρούμε ότι από τη διασταύρωση προκύπτουν 160 θηλυκοί απόγονοι και 80 αρσενικοί. Άρα υπάρχει φυλοσύνδετο θνησιγόνο αλληλόμορφο. Επίσης παρατηρούμε ότι υπάρχουν μόνο απόγονοι οι οποίοι παράγουν την πρωτεΐνη Α και καθόλου απόγονοι που δεν την παράγουν. Επομένως:

ΧΑ: το αλληλόμορφο που είναι υπεύθυνο για τη σύνθεση της πρωτεΐνης Α και

Χα: το αλληλόμορφο που δεν συνθέτει την πρωτεΐνη Α, το οποίο είναι και θνησιγόνο. Οι συνολικοί γονότυποι των γονέων είναι: Κ1Κ3ΧΑΧα (x) K2K3ΧΑΥ

 

Τα άτομα με γονότυπο ΧαΥ πεθαίνουν και η φαινοτυπική αναλογία των απογόνων είναι:

4 θηλυκά με κίτρινο χρώμα και παραγωγή πρωτεΐνης Α: 2 θηλυκά με μαύρο χρώμα και παραγωγή πρωτεΐνης Α: 2 θηλυκά με άσπρο χρώμα και παραγωγή πρωτεΐνης Α: 2 αρσενικά με κίτρινο χρώμα και παραγωγή πρωτεΐνης Α: 1 αρσενικό με μαύρο χρώμα και παραγωγή πρωτεΐνης Α: 1 αρσενικό με άσπρο χρώμα και παραγωγή πρωτεΐνης Α. Η αναλογία 4:2:2:2:1:1 είναι ίση με την αναλογία 80:40:40:40:20:20 που δίνεται, επομένως η διασταύρωση εξηγεί τα αποτελέσματα της άσκησης. 

Παρατήρηση: Η άσκηση θα μπορούσε να λυθεί και σαν διασταύρωση τριυβριδισμού, αν το θνησιγόνο γονίδιο ήταν διαφορετικό από το γονίδιο που δημιουργεί την πρωτεΐνη Α. 

Γ2. Η διασταύρωση με την οποία μπορούμε να διαπιστώσουμε αν το γονίδιο είναι αυτοσωμικό ή φυλοσύνδετο είναι ένα θηλυκό με μικρές κεραίες με ένα αρσενικό με μεγάλες κεραίες.

Αν το γονίδιο κληρονομείται με αυτοσωμικό τρόπο:

Έστω: Μ: το αλληλόμορφο που δημιουργεί μεγάλο μήκος κεραιών μ: το αλληλόμορφο που δημιουργεί μικρό μήκος κεραιών

Το αμιγές θηλυκό έχει γονότυπο μμ, ενώ το αμιγές αρσενικό έχει γονότυπο ΜΜ. Η διασταύρωση είναι η εξής:

P γενιά: μμ (x) ΜΜ γαμέτες: μ Μ F1 γενιά: Μμ

Φ. Α: όλοι οι απόγονοι έχουν κεραίες μεγάλου μήκους

Αν το γονίδιο κληρονομείται με φυλοσύνδετο τρόπο:

Έστω: ΧΜ: το αλληλόμορφο που δημιουργεί μεγάλο μήκος κεραιών Χμ: το αλληλόμορφο που δημιουργεί μικρό μήκος κεραιών

Το αμιγές θηλυκό έχει γονότυπο ΧμΧμ, ενώ το αμιγές αρσενικό έχει γονότυπο ΧΜΥ. Η διασταύρωση είναι η εξής:

P γενιά: ΧμΧμ (x) ΧΜΥ γαμέτες:     Χμ     ΧΜ, Υ F1 γενιά: ΧΜΧμ, ΧμΥ

Φ.Α: όλοι οι θηλυκοί απόγονοι έχουν κεραίες μεγάλου μήκους και όλοι οι αρσενικοί απόγονοι έχουν κεραίες μικρού μήκους.

Με βάση τα αποτελέσματα της διασταύρωσης μπορούμε να διαπιστώσουμε αν το γονίδιο κληρονομείται με αυτοσωμικό ή με φυλοσύνδετο τρόπο. 

Γ3. Με τη διαδικασία του μετασχηματισμού δημιουργούνται τρεις κατηγορίες βακτηρίων:

  • βακτήρια που προσέλαβαν το ανασυνδυασμένο πλασμίδιο. Στο ανασυνδυασμένο πλασμίδιο το γονίδιο της πρωτεΐνης Α ενσωματώνεται στο 1ο δομικό γονίδιο του οπερονίου της λακτόζης και το απενεργοποιεί. Επομένως, τα βακτήρια αυτά είναι ανθεκτικά στην αμπικιλίνη, αλλά δεν μπορούν να διασπάσουν τη λακτόζη.
  • βακτήρια που προσέλαβαν το μη ανασυνδυασμένο πλασμίδιο, δηλαδή πλασμίδιο που ξαναέγινε κυκλικό, χωρίς να προσλάβει το cDNA της άσκησης. Τα βακτήρια αυτά είναι ανθεκτικά στην αμπικιλίνη και μπορούν να διασπάσουν τη λακτόζη.
  • βακτήρια που δεν προσέλαβαν κάποιο πλασμίδιο. Τα βακτήρια αυτά δεν είναι ανθεκτικά στην αμπικιλίνη και δεν μπορούν να διασπάσουν τη λακτόζη, αφού στο συγκεκριμένο βακτηριακό στέλεχος E. coli δεν λειτουργεί το οπερόνιο της λακτόζης που υπάρχει στο κύριο μόριο DNA.

Στην καλλιέργεια Α υπάρχει αμπικιλίνη και ως πηγή άνθρακα χρησιμοποιείται η γλυκόζη. Επομένως, στην καλλιέργεια αυτή αναπτύσσονται τα βακτήρια με το ανασυνδυασμένο πλασμίδιο και τα βακτήρια με το μη ανασυνδυασμένο πλασμίδιο.

Στην καλλιέργεια Β υπάρχει αμπικιλίνη και ως πηγή άνθρακα χρησιμοποιείται η λακτόζη. Επομένως, στην καλλιέργεια αυτή αναπτύσσονται μόνο τα βακτήρια με το μη ανασυνδυασμένο πλασμίδιο.

ΘΕΜΑ Δ

Δ1. Το φυσιολογικό αλληλόμορφο δεν κόβεται από την EcoRI, ενώ το μεταλλαγμένο αλληλόμορφο κόβεται μία φορά. Επομένως, αν το τμήμα DNA ενός ατόμου δημιουργεί, μετά τη δράση της EcoRI, 2 είδη κομματιών DNA, τότε το άτομο φέρει μόνο το μεταλλαγμένο αλληλόμορφο. Αν το τμήμα DNA ενός ατόμου δημιουργεί 1 είδος κομματιού DNA, τότε το άτομο φέρει μόνο το φυσιολογικό αλληλόμορφο. Αν το τμήμα DNA ενός ατόμου δημιουργεί 3 είδη κομματιών DNA, τότε το άτομο είναι ετερόζυγο. Διακρίνουμε της εξής περιπτώσεις:

Αν η ασθένεια κληρονομείται με αυτοσωμικό επικρατή τρόπο: Α: το αλληλόμορφο που προκαλεί την ασθένεια,

α: το φυσιολογικό αλληλόμορφο

Το άτομο ΙΙ1 δημιουργεί δύο είδη τμημάτων DNA μήκους 600 ζ.β. και 400 ζ.β., επομένως το άτομο αυτό φέρει μόνο το μεταλλαγμένο αλληλόμορφο και έχει γονότυπο ΑΑ. Το άτομο Ι2 είναι υγιές επομένως έχει γονότυπο αα. Το άτομο αυτό έπρεπε να είχε κληρονομήσει ένα α στο άτομο ΙΙ1, κάτι που δεν ισχύει. Επομένως απορρίπτεται η περίπτωση της αυτοσωμικής επικρατής κληρονομικότητας.

Αν η ασθένεια κληρονομείται με αυτοσωμικό υπολειπόμενο τρόπο: Α: το φυσιολογικό αλληλόμορφο,

α: το αλληλόμορφο που προκαλεί την ασθένεια

Το άτομο ΙΙ2 δημιουργεί ένα είδος τμήματος DNA μήκους 1000 ζ.β., επομένως το άτομο αυτό φέρει μόνο το φυσιολογικό αλληλόμορφο και έχει γονότυπο ΑΑ. Το άτομο Ι1 πάσχει επομένως έχει γονότυπο αα. Το άτομο αυτό έπρεπε να είχε κληρονομήσει ένα α στο άτομο ΙΙ2, κάτι που δεν ισχύει. Επομένως απορρίπτεται η περίπτωση της αυτοσωμικής υπολειπόμενης κληρονομικότητας.

Αν η ασθένεια κληρονομείται με φυλοσύνδετο υπολειπόμενο τρόπο: ΧΑ: το φυσιολογικό αλληλόμορφο,

Χα: το αλληλόμορφο που προκαλεί την ασθένεια

Το άτομο ΙΙ1 δημιουργεί δύο είδη τμημάτων DNA μήκους 600 ζ.β. και 400 ζ.β., επομένως το άτομο αυτό φέρει μόνο το μεταλλαγμένο αλληλόμορφο και έχει γονότυπο ΧαΧα. Το άτομο  ΙΙ2 δημιουργεί ένα είδος τμήματος DNA μήκους 1000 ζ.β., επομένως το άτομο αυτό φέρει μόνο το φυσιολογικό αλληλόμορφο και έχει γονότυπο ΧΑΥ. Το άτομο Ι1 πάσχει επομένως έχει γονότυπο ΧαΥ Το άτομο Ι2 έχει ένα XA αλληλόμορφο επειδή είναι υγιές και ένα Χα αλληλόμορφο, το οποίο κληροδότησε στο γιο της που πάσχει. Επομένως έχει γονότυπο ΧΑΧα. Τα παραπάνω φαίνονται και από την διασταύρωση:

P γενιά: ΧαΥ (x) ΧΑΧα γαμέτες:  Χα, Υ ΧΑ, Χα

F1 γενιά: ΧΑΧα, ΧαΧα, ΧΑΥ, ΧαΥ

Η διασταύρωση επιβεβαιώνει τα αποτελέσματα, επομένως η ασθένεια κληρονομείται με φυλοσύνδετο υπολειπόμενο τρόπο.

Δ2. Με βάση την απάντηση στο Δ1, το άτομο II1 έχει γονότυπο ΧαΧα και θα εμφανίσει τα συμπτώματα της ασθένειας, ενώ το άτομο ΙΙ2 έχει γονότυπο ΧΑΥ και δεν θα εμφανίσει τα συμπτώματα της ασθένειας. 

Δ3. Με βάση την απάντηση στο Δ1, το άτομο Ι1 έχει γονότυπο ΧαΥ, επομένως θα προκύψουν δύο είδη κομματιών DNA μήκους 600 ζ.β. και 400 ζ.β., ενώ το άτομο Ι2 γονότυπο ΧΑΧα, επομένως θα δημιουργήσει τρία είδη κομματιών DNA μήκους 1000 ζ.β., 600 ζ.β. και 400 ζ.β.

Δ4. α. Μία από τις περιοριστικές ενδονουκλεάσες που χρησιμοποιείται ευρέως είναι η EcoRI που απομονώθηκε από το βακτήριο Escherichia coli (Εικόνα 4.2). Το ένζυμο αυτό όποτε συναντά την αλληλουχία: 5'-G Α Α Τ Τ C-3'

3'-C Τ Τ A A G-5' στο γονιδίωμα, κόβει κάθε αλυσίδα μεταξύ του G και του Α (με κατεύθυνση 5'3') αφήνοντας μονόκλωνα άκρα από αζευγάρωτες βάσεις στα κομμένα άκρα.

 Στο τμήμα της αλληλουχίας της κωδικής αλυσίδας του φυσιολογικού γονιδίου εντοπίζεται από αριστερά προς τα δεξιά το κωδικόνιο έναρξης ATG. Αν στο τέταρτο κωδικόνιο TCA γίνει αντικατάσταση της C από G, τότε δημιουργείται στο γονίδιο η αλληλουχία που αναγνωρίζει η EcoRI, η οποία, όπως αναφέρθηκε στο Δ1 ερώτημα, υπάρχει μόνο στο μεταλλαγμένο αλληλόμορφο. Επομένως, η αλληλουχία του αντίστοιχου τμήματος της κωδικής αλυσίδας του μεταλλαγμένου αλληλομόρφου είναι:

5΄…CGAACGATGCCAGTCTGAATTCACGGA…3΄

β. Λόγω της αντικατάστασης της βάσης το τέταρτο κωδικόνιο μετατρέπεται σε TGA, το οποίο αντιστοιχεί στο κωδικόνιο λήξης της μετάφρασης UGA. Το αποτέλεσμα είναι ο πρόωρος τερματισμός της σύνθεσης της πολυπεπτιδικής αλυσίδας. Έτσι, η μεταλλαγμένη πρωτεΐνη έχει λιγότερα αμινοξέα από τη φυσιολογική και είναι μη λειτουργική. Το γεγονός ότι καταστρέφεται η λειτουργικότητα της παραγόμενης πρωτεΐνης προκύπτει και από το γεγονός ότι η συγκεκριμένη μετάλλαξη προκαλεί την ασθένεια της άσκησης.

Για να δείτε τις απαντήσεις σε μορφή pdf πατήστε ΕΔΩ.

Δείτε εδώ τα θέματα.

Φοιτητικά Νέα/Foititikanea.gr


1 1 1 1 1 Αξιολόγηση 0.00 (0 ψήφοι)